Transcript: Human NM_001168683.1

Homo sapiens taxilin gamma (TXLNG), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-10-13
Taxon:
Homo sapiens (human)
Gene:
TXLNG (55787)
Length:
4022
CDS:
57..1247

Additional Resources:

NCBI RefSeq record:
NM_001168683.1
NBCI Gene record:
TXLNG (55787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142856 CAGCGTCACAATAAGACGTTA pLKO.1 306 CDS 100% 4.950 6.930 N TXLNG n/a
2 TRCN0000139267 CGACGTAAAGAAGCAACTGCA pLKO.1 366 CDS 100% 2.640 3.696 N TXLNG n/a
3 TRCN0000144587 GCAAACGACACAACTGATAAA pLKO.1 587 CDS 100% 13.200 9.240 N TXLNG n/a
4 TRCN0000139886 GCAGCAAACGACACAACTGAT pLKO.1 584 CDS 100% 4.950 3.465 N TXLNG n/a
5 TRCN0000143550 GAGTGAACATAGCAAGGCTAT pLKO.1 245 CDS 100% 4.050 2.835 N TXLNG n/a
6 TRCN0000139266 CTCCACTGGAATGCATGTGTT pLKO.1 1469 3UTR 100% 4.950 2.970 N TXLNG n/a
7 TRCN0000143605 GCAAATGAAGATCCTGCAGAA pLKO.1 185 CDS 100% 4.050 2.430 N TXLNG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.