Transcript: Mouse NM_001170395.1

Mus musculus CD163 antigen (Cd163), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cd163 (93671)
Length:
4492
CDS:
90..3569

Additional Resources:

NCBI RefSeq record:
NM_001170395.1
NBCI Gene record:
Cd163 (93671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067689 CCTGCTCAGATGGATCTAATT pLKO.1 532 CDS 100% 13.200 9.240 N Cd163 n/a
2 TRCN0000067692 GCAACAAATACGTGGCTCTTT pLKO.1 1380 CDS 100% 4.950 3.465 N Cd163 n/a
3 TRCN0000067690 GCACTGGGAAAGAGTCTCATA pLKO.1 2452 CDS 100% 4.950 3.465 N Cd163 n/a
4 TRCN0000067691 CCTGGGATCTTAATGATGCTA pLKO.1 2962 CDS 100% 3.000 2.100 N Cd163 n/a
5 TRCN0000067688 CCTGAGTTCAATTCCTAGCAA pLKO.1 4182 3UTR 100% 3.000 1.500 Y Cd163 n/a
6 TRCN0000198922 GCTTCCCAAATGCTGGGATTA pLKO.1 3843 3UTR 100% 1.080 0.540 Y Tyw1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.