Transcript: Human NM_001170414.2

Homo sapiens tight junction protein 2 (TJP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
TJP2 (9414)
Length:
4129
CDS:
233..3295

Additional Resources:

NCBI RefSeq record:
NM_001170414.2
NBCI Gene record:
TJP2 (9414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315436 ATAGAGTCAAACCGATCATTT pLKO_005 1385 CDS 100% 13.200 18.480 N TJP2 n/a
2 TRCN0000006166 CGGTTAAATACCGTGAGGCAA pLKO.1 2486 CDS 100% 2.640 2.112 N TJP2 n/a
3 TRCN0000006163 CCAGCTTAATAGCTGTAGTTT pLKO.1 3840 3UTR 100% 0.563 0.450 N TJP2 n/a
4 TRCN0000356774 GGCAATGATGTCGGGATATTT pLKO_005 1745 CDS 100% 15.000 10.500 N TJP2 n/a
5 TRCN0000356775 AGCAATATATGGCCCTAATAC pLKO_005 1672 CDS 100% 13.200 9.240 N TJP2 n/a
6 TRCN0000315397 GCTTTAGGCAGAGCCATAATG pLKO_005 3790 3UTR 100% 13.200 9.240 N TJP2 n/a
7 TRCN0000006164 CGAGTGGTAGACACACTGTAT pLKO.1 2057 CDS 100% 4.950 3.465 N TJP2 n/a
8 TRCN0000006167 CGTCATCAGTATTCTGATTAT pLKO.1 1421 CDS 100% 1.320 0.924 N TJP2 n/a
9 TRCN0000315435 CGTCATCAGTATTCTGATTAT pLKO_005 1421 CDS 100% 1.320 0.924 N TJP2 n/a
10 TRCN0000091771 GCCTACACTGACAATGAGCTA pLKO.1 2954 CDS 100% 2.640 1.848 N Tjp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.