Transcript: Mouse NM_001170479.1

Mus musculus BLOC-1 related complex subunit 5 (Borcs5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Mus musculus (mouse)
Gene:
Borcs5 (67774)
Length:
1635
CDS:
116..706

Additional Resources:

NCBI RefSeq record:
NM_001170479.1
NBCI Gene record:
Borcs5 (67774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181531 GCGAATCAAAGAGATGGATCT pLKO.1 466 CDS 100% 4.050 5.670 N Borcs5 n/a
2 TRCN0000181863 GCTCTAGTCAAGCGAATCAAA pLKO.1 455 CDS 100% 5.625 4.500 N Borcs5 n/a
3 TRCN0000216315 GAAGTTGGGACAGTTGAATTT pLKO.1 816 3UTR 100% 13.200 9.240 N Borcs5 n/a
4 TRCN0000182045 CGATCAGAATGCTCTAGTCAA pLKO.1 445 CDS 100% 4.950 3.465 N Borcs5 n/a
5 TRCN0000182078 CTCTCTGATCTGTGGCTGTAA pLKO.1 992 3UTR 100% 4.950 3.465 N Borcs5 n/a
6 TRCN0000182399 GAGCAGATCCAGAAGGTGAAT pLKO.1 548 CDS 100% 4.950 3.465 N Borcs5 n/a
7 TRCN0000181655 GAATGCTCTAGTCAAGCGAAT pLKO.1 451 CDS 100% 4.050 2.835 N Borcs5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.