Transcript: Human NM_001170700.3

Homo sapiens death domain containing 1 (DTHD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DTHD1 (401124)
Length:
6551
CDS:
144..2864

Additional Resources:

NCBI RefSeq record:
NM_001170700.3
NBCI Gene record:
DTHD1 (401124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283761 TGAATCAATCTCTCGTAATTA pLKO_005 2410 CDS 100% 15.000 21.000 N DTHD1 n/a
2 TRCN0000268684 AGTTAGTTAGCAACGTCATAA pLKO_005 1165 CDS 100% 13.200 18.480 N DTHD1 n/a
3 TRCN0000283763 TAGGATTACACCTTCGTATTT pLKO_005 1760 CDS 100% 13.200 18.480 N DTHD1 n/a
4 TRCN0000283762 CAACTAGAATGCCGGATAATA pLKO_005 1107 CDS 100% 15.000 10.500 N DTHD1 n/a
5 TRCN0000268685 CTGGAAGTTTCCGAATGATAT pLKO_005 2935 3UTR 100% 13.200 9.240 N DTHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10127 pDONR223 100% 86.1% 85.9% None 1_375del;911T>A;2029C>T n/a
2 ccsbBroad304_10127 pLX_304 0% 86.1% 85.9% V5 1_375del;911T>A;2029C>T n/a
Download CSV