Transcript: Human NM_001170717.3

Homo sapiens BCAR1 scaffold protein, Cas family member (BCAR1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
BCAR1 (9564)
Length:
4139
CDS:
143..2809

Additional Resources:

NCBI RefSeq record:
NM_001170717.3
NBCI Gene record:
BCAR1 (9564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436978 GGATGGAGGACTATGACTACG pLKO_005 2175 CDS 100% 4.050 5.670 N BCAR1 n/a
2 TRCN0000115984 GCTGAAGCAGTTTGAACGACT pLKO.1 2296 CDS 100% 2.640 3.696 N BCAR1 n/a
3 TRCN0000426190 GCGTGAGGAGACCTACGATGT pLKO_005 1162 CDS 100% 1.350 1.890 N BCAR1 n/a
4 TRCN0000115985 CCTTGCAGTACCCATCGCCTT pLKO.1 2697 CDS 100% 0.720 1.008 N BCAR1 n/a
5 TRCN0000115986 CGTGGTCGACAGTGGTGTGTA pLKO.1 1405 CDS 100% 1.650 1.320 N BCAR1 n/a
6 TRCN0000115982 CCCAGGAATCTGTATATATTT pLKO.1 2943 3UTR 100% 15.000 10.500 N BCAR1 n/a
7 TRCN0000115983 GCCACAGGACATCTATGATGT pLKO.1 874 CDS 100% 4.950 3.465 N BCAR1 n/a
8 TRCN0000441553 AGATCTTTGTGGCGCACAGCA pLKO_005 2523 CDS 100% 2.640 1.848 N BCAR1 n/a
9 TRCN0000427105 GGGCATGTATGATAAGAAGCC pLKO_005 334 CDS 100% 2.160 1.512 N BCAR1 n/a
10 TRCN0000423056 GACATGGTGGAGAGGGTCAAG pLKO_005 2729 CDS 100% 1.350 0.945 N BCAR1 n/a
11 TRCN0000442341 AGCGCTCTATGACAATGTGGC pLKO_005 169 CDS 100% 2.160 1.296 N BCAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.