Transcript: Mouse NM_001170851.1

Mus musculus killer cell lectin-like receptor, subfamily A, member 2 (Klra2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Klra2 (16633)
Length:
1886
CDS:
167..1132

Additional Resources:

NCBI RefSeq record:
NM_001170851.1
NBCI Gene record:
Klra2 (16633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094800 GCTAGAAATCATGGTTGTATT pLKO.1 1019 CDS 100% 13.200 9.240 N Klra2 n/a
2 TRCN0000094802 CCCAACTTCAAAGAAACACAT pLKO.1 747 CDS 100% 4.950 3.465 N Klra2 n/a
3 TRCN0000094803 GTGCTAGAAATCATGGTTGTA pLKO.1 1017 CDS 100% 4.950 3.465 N Klra2 n/a
4 TRCN0000094801 CCTCAATGATAGCCTGCACTA pLKO.1 502 CDS 100% 4.050 2.835 N Klra2 n/a
5 TRCN0000094799 CCTGAATTATACACAGAACAA pLKO.1 1252 3UTR 100% 4.950 2.970 N Klra2 n/a
6 TRCN0000068143 CCCTGGAAGTTCATTGTGATA pLKO.1 290 CDS 100% 4.950 2.475 Y Klra22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.