Transcript: Mouse NM_001171052.1

Mus musculus metastasis associated 3 (Mta3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mta3 (116871)
Length:
2673
CDS:
96..1856

Additional Resources:

NCBI RefSeq record:
NM_001171052.1
NBCI Gene record:
Mta3 (116871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001171052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231174 TCGTGTATCATTGGGTATTTA pLKO_005 1680 CDS 100% 15.000 21.000 N Mta3 n/a
2 TRCN0000231171 CACTTACGGATCGACAGATTG pLKO_005 655 CDS 100% 10.800 15.120 N Mta3 n/a
3 TRCN0000081869 CCGCAAAGAAACCTAATGTAA pLKO.1 1711 CDS 100% 5.625 7.875 N Mta3 n/a
4 TRCN0000081871 CGTGTTGTCATACCTTGACAA pLKO.1 452 CDS 100% 0.495 0.693 N Mta3 n/a
5 TRCN0000081870 CGGCAAAGATTTCAACGACAT pLKO.1 953 CDS 100% 4.050 2.835 N Mta3 n/a
6 TRCN0000231173 ACGGCCGTTTGTTGCTATTAA pLKO_005 1571 CDS 100% 15.000 9.000 N Mta3 n/a
7 TRCN0000081872 CGGCCGTTTGTTGCTATTAAT pLKO.1 1572 CDS 100% 15.000 9.000 N Mta3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.