Transcript: Mouse NM_001171512.2

Mus musculus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Obscn (380698)
Length:
24175
CDS:
1..24099

Additional Resources:

NCBI RefSeq record:
NM_001171512.2
NBCI Gene record:
Obscn (380698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001171512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024469 CGGATCTATATGACATCAAAT pLKO.1 22118 CDS 100% 13.200 18.480 N Obscn n/a
2 TRCN0000110015 CATTCCTTCTATGACGTTCAA pLKO.1 19675 CDS 100% 4.950 6.930 N Obscn n/a
3 TRCN0000024472 GCTAAGATCGTTCCCTACCAA pLKO.1 23290 CDS 100% 3.000 4.200 N Obscn n/a
4 TRCN0000110017 GTCGCTGCTATGCAGGATTAT pLKO.1 23852 CDS 100% 13.200 9.240 N Obscn n/a
5 TRCN0000024470 GCGTTCCTTGATGAGCTACAA pLKO.1 20526 CDS 100% 4.950 3.465 N Obscn n/a
6 TRCN0000110019 ACAGACAGACATTTGGGCTAT pLKO.1 23730 CDS 100% 4.050 2.835 N Obscn n/a
7 TRCN0000110016 CAGGACAGTTGTAGAGGGAAA pLKO.1 21364 CDS 100% 4.050 2.835 N Obscn n/a
8 TRCN0000024473 CTACACTATTTGCACAGCCAT pLKO.1 20005 CDS 100% 2.640 1.848 N Obscn n/a
9 TRCN0000110018 GCCACCCACCACCCATAGTAA pLKO.1 19430 CDS 100% 1.875 1.313 N Obscn n/a
10 TRCN0000162384 CAGTGGTACAAGGATGACAAA pLKO.1 7966 CDS 100% 4.950 2.475 Y NTM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.