Transcript: Human NM_001171654.1

Homo sapiens kelch like family member 5 (KLHL5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
KLHL5 (51088)
Length:
7189
CDS:
306..2012

Additional Resources:

NCBI RefSeq record:
NM_001171654.1
NBCI Gene record:
KLHL5 (51088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423958 AGACGGAAAGATCTAAGTAAA pLKO_005 936 CDS 100% 13.200 18.480 N KLHL5 n/a
2 TRCN0000116330 CCAATAGTAGTCAGACATTAT pLKO.1 271 5UTR 100% 13.200 18.480 N KLHL5 n/a
3 TRCN0000427863 TATTACCAGCCAGCGAAATTG pLKO_005 823 CDS 100% 13.200 18.480 N KLHL5 n/a
4 TRCN0000116327 CCTGCCTTATTTCTTATGTTT pLKO.1 2910 3UTR 100% 5.625 3.938 N KLHL5 n/a
5 TRCN0000116331 CTTGTCTCAAATCAGTAGAAT pLKO.1 1603 CDS 100% 5.625 3.938 N KLHL5 n/a
6 TRCN0000116329 GCTAGTGATGACATGAACATT pLKO.1 855 CDS 100% 5.625 3.938 N KLHL5 n/a
7 TRCN0000116328 CCCTTAATCATGCCGAGCAAA pLKO.1 340 CDS 100% 4.950 3.465 N KLHL5 n/a
8 TRCN0000434441 AGTCAACTGTTGGTACATTAT pLKO_005 1132 CDS 100% 13.200 7.920 N KLHL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.