Transcript: Mouse NM_001173460.1

Mus musculus signal-regulatory protein beta 1B (Sirpb1b), mRNA.

Source:
NCBI, updated 2018-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sirpb1b (668101)
Length:
1496
CDS:
116..1291

Additional Resources:

NCBI RefSeq record:
NM_001173460.1
NBCI Gene record:
Sirpb1b (668101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001173460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112289 CCTGGTTAGAGAATGGAAATA pLKO.1 966 CDS 100% 13.200 6.600 Y Sirpb1a n/a
2 TRCN0000112288 CTGCCAAATACAGAAGTTCTA pLKO.1 925 CDS 100% 4.950 2.475 Y Sirpb1a n/a
3 TRCN0000112286 GCAGCCAACAATGGTATGGAA pLKO.1 889 CDS 100% 3.000 1.500 Y Sirpb1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.