Transcript: Mouse NM_001173506.1

Mus musculus microtubule-associated protein 1 A (Map1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Map1a (17754)
Length:
11553
CDS:
464..8794

Additional Resources:

NCBI RefSeq record:
NM_001173506.1
NBCI Gene record:
Map1a (17754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001173506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091990 CCGCAATAAGTCTGCAGAGAA pLKO.1 6400 CDS 100% 4.950 6.930 N Map1a n/a
2 TRCN0000091991 GCCAACTTGAAACCCAGCAAA pLKO.1 1379 CDS 100% 4.950 3.960 N Map1a n/a
3 TRCN0000091988 CCAGGAGAAACCAGCCTTAAT pLKO.1 7481 CDS 100% 13.200 7.920 N Map1a n/a
4 TRCN0000091989 CGAGACCATCATCCTAGTCAA pLKO.1 124 5UTR 100% 4.950 2.970 N Map1a n/a
5 TRCN0000374166 AGGAGAAGAAGGAGATCAAAT pLKO_005 1716 CDS 100% 13.200 6.600 Y Tfdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.