Transcript: Mouse NM_001174047.1

Mus musculus calcium channel, voltage-dependent, alpha 2/delta subunit 2 (Cacna2d2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cacna2d2 (56808)
Length:
5539
CDS:
190..3660

Additional Resources:

NCBI RefSeq record:
NM_001174047.1
NBCI Gene record:
Cacna2d2 (56808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001174047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055198 GCGGGCTAACTGCAATAAGAT pLKO.1 1362 CDS 100% 5.625 7.875 N Cacna2d2 n/a
2 TRCN0000055201 GCCTATAAGGAGTACCAACTA pLKO.1 2082 CDS 100% 4.950 6.930 N Cacna2d2 n/a
3 TRCN0000055199 GCATCCTATAATGCCATCATT pLKO.1 3277 CDS 100% 5.625 4.500 N Cacna2d2 n/a
4 TRCN0000271264 ACTACACCTGGGTGCCTATAA pLKO_005 2069 CDS 100% 13.200 9.240 N CACNA2D2 n/a
5 TRCN0000045083 CCGCATCAACACACAGGAATA pLKO.1 1572 CDS 100% 10.800 7.560 N CACNA2D2 n/a
6 TRCN0000055200 CCGAAAGGAATCCTATGACTA pLKO.1 2997 CDS 100% 4.950 3.465 N Cacna2d2 n/a
7 TRCN0000055202 CCGAGAGATCTACAAGGACAA pLKO.1 480 CDS 100% 4.050 2.835 N Cacna2d2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4701 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.