Transcript: Mouse NM_001174086.1

Mus musculus shisa family member 9 (Shisa9), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Shisa9 (72555)
Length:
4796
CDS:
469..1695

Additional Resources:

NCBI RefSeq record:
NM_001174086.1
NBCI Gene record:
Shisa9 (72555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001174086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342086 ACAACTCTACTGCCAACTTTA pLKO_005 1505 CDS 100% 13.200 18.480 N Shisa9 n/a
2 TRCN0000337328 CAACAAGTACGCCTCCTTAAA pLKO_005 1287 CDS 100% 13.200 9.240 N SHISA9 n/a
3 TRCN0000342101 CAACAAGTACGCCTCCTTAAA pLKO_005 1287 CDS 100% 13.200 9.240 N Shisa9 n/a
4 TRCN0000342012 CAACCACAGACCTACTCATAA pLKO_005 1836 3UTR 100% 13.200 9.240 N Shisa9 n/a
5 TRCN0000337327 CGGTTCTGCTGCACGTTTAAG pLKO_005 781 CDS 100% 13.200 9.240 N SHISA9 n/a
6 TRCN0000342033 CGGTTCTGCTGCACGTTTAAG pLKO_005 781 CDS 100% 13.200 9.240 N Shisa9 n/a
7 TRCN0000342084 CACATGGAGAGAGACCTTAAC pLKO_005 1078 CDS 100% 10.800 6.480 N Shisa9 n/a
8 TRCN0000139309 CCTGCTCTCTTGTTTCTCACT pLKO.1 3740 3UTR 100% 2.640 1.848 N CCDC57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.