Transcript: Mouse NM_001177480.1

Mus musculus predicted gene 14391 (Gm14391), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-08
Taxon:
Mus musculus (mouse)
Gene:
Gm14391 (665001)
Length:
946
CDS:
197..406

Additional Resources:

NCBI RefSeq record:
NM_001177480.1
NBCI Gene record:
Gm14391 (665001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231379 TCACAGCTATAGGTTACATTT pLKO_005 315 CDS 100% 13.200 6.600 Y 0610010B08Rik n/a
2 TRCN0000234269 TCACAGCTATAGGTTACATTT pLKO_005 315 CDS 100% 13.200 6.600 Y 9230108I15Rik n/a
3 TRCN0000239781 ACATACGATTGAAGACCATTT pLKO_005 343 CDS 100% 10.800 5.400 Y Gm6710 n/a
4 TRCN0000243733 ATAGGAATCTCACAGCTATAG pLKO_005 306 CDS 100% 10.800 5.400 Y Gm14322 n/a
5 TRCN0000239455 CTCAGAAGAGTCTCTACAAAG pLKO_005 267 CDS 100% 10.800 5.400 Y Gm14288 n/a
6 TRCN0000239782 TGTGATGCTAGAGACCTATAG pLKO_005 289 CDS 100% 10.800 5.400 Y Gm6710 n/a
7 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 274 CDS 100% 4.950 2.475 Y Gm4983 n/a
8 TRCN0000235325 GTGATGCTAGAGACCTATAAG pLKO_005 290 CDS 100% 13.200 6.600 Y OTTMUSG00000016228 n/a
9 TRCN0000231378 TGTGATGCTAGAGACCTATAA pLKO_005 289 CDS 100% 13.200 6.600 Y 0610010B08Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.