Transcript: Mouse NM_001177570.1

Mus musculus zinc finger protein 616 (Zfp616), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Zfp616 (327963)
Length:
4818
CDS:
424..3387

Additional Resources:

NCBI RefSeq record:
NM_001177570.1
NBCI Gene record:
Zfp616 (327963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257199 AGACGTCATGTTGGAGAATTA pLKO_005 265 5UTR 100% 13.200 7.920 N Zfp616 n/a
2 TRCN0000242165 GTTCATGGATGTGGCTATAGA pLKO_005 190 5UTR 100% 5.625 3.375 N Zfp616 n/a
3 TRCN0000191011 CAGGAGACAAACCTTACAAAT pLKO.1 2186 CDS 100% 13.200 6.600 Y Zfp945 n/a
4 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 2196 CDS 100% 10.800 5.400 Y Rex2 n/a
5 TRCN0000256981 TTCTGTGGGTGTTGCTGTTTC pLKO_005 298 5UTR 100% 10.800 5.400 Y Zfp616 n/a
6 TRCN0000242167 CTCTAAGGAGGAGTGGGAATG pLKO_005 214 5UTR 100% 6.000 3.000 Y Zfp616 n/a
7 TRCN0000242166 ACAAAGAACCATGGATTGTTG pLKO_005 351 5UTR 100% 4.950 2.475 Y Zfp616 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.