Transcript: Mouse NM_001177775.1

Mus musculus histocompatibility 60b (H60b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
H60b (667281)
Length:
952
CDS:
97..852

Additional Resources:

NCBI RefSeq record:
NM_001177775.1
NBCI Gene record:
H60b (667281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086897 TGAGGGAAATGCTACAGAGAT pLKO.1 276 CDS 100% 4.950 3.465 N H60a n/a
2 TRCN0000086893 GCCTTGAATGTCACAACACAA pLKO.1 367 CDS 100% 4.950 2.970 N H60a n/a
3 TRCN0000086895 CCTACAGTGAATAACTCCCAA pLKO.1 679 CDS 100% 2.640 1.584 N H60a n/a
4 TRCN0000086896 TCACCTGGATTGTGATTATAT pLKO.1 728 CDS 100% 15.000 7.500 Y H60a n/a
5 TRCN0000086894 GCTTGGTGTATGCTGAAGAAA pLKO.1 790 CDS 100% 5.625 2.813 Y H60a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.