Transcript: Mouse NM_001177794.1

Mus musculus SERTA domain containing 4 (Sertad4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Sertad4 (214791)
Length:
3108
CDS:
73..1206

Additional Resources:

NCBI RefSeq record:
NM_001177794.1
NBCI Gene record:
Sertad4 (214791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247968 AGCCCGTGGCATGCGTTATAT pLKO_005 2385 3UTR 100% 15.000 21.000 N Sertad4 n/a
2 TRCN0000247971 CAAATACCCGCCAGCGAAATC pLKO_005 910 CDS 100% 10.800 15.120 N Sertad4 n/a
3 TRCN0000247969 ACACCTGGCAGGATCACATTA pLKO_005 237 CDS 100% 13.200 9.240 N Sertad4 n/a
4 TRCN0000192240 CCATGCAGTTTGGAAACTTAA pLKO.1 2138 3UTR 100% 13.200 9.240 N Sertad4 n/a
5 TRCN0000247970 TTTGAGTGCAAAGGCCAATTT pLKO_005 1060 CDS 100% 13.200 9.240 N Sertad4 n/a
6 TRCN0000216217 CAACAATGATGGGAAAGTAAG pLKO.1 978 CDS 100% 10.800 7.560 N Sertad4 n/a
7 TRCN0000247967 GGAGCGAGCACACATCCTTTA pLKO_005 381 CDS 100% 10.800 7.560 N Sertad4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.