Transcript: Mouse NM_001177832.1

Mus musculus predicted gene 10324 (Gm10324), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm10324 (628709)
Length:
1920
CDS:
106..1920

Additional Resources:

NCBI RefSeq record:
NM_001177832.1
NBCI Gene record:
Gm10324 (628709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 397 CDS 100% 15.000 7.500 Y Gm10771 n/a
2 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 397 CDS 100% 15.000 7.500 Y ZNF286B n/a
3 TRCN0000235275 CAGTAATCTCAGATATCATAA pLKO_005 534 CDS 100% 13.200 6.600 Y Gm10771 n/a
4 TRCN0000235272 TTACTTCTATAGGCTACAAAT pLKO_005 224 CDS 100% 13.200 6.600 Y Gm10771 n/a
5 TRCN0000235274 ATACTGGAGAGAGACCTTATG pLKO_005 479 CDS 100% 10.800 5.400 Y Gm10771 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 566 CDS 100% 5.625 2.813 Y ZNF345 n/a
7 TRCN0000095712 CCTTACTTCTATAGGCTACAA pLKO.1 222 CDS 100% 4.950 2.475 Y 2410141K09Rik n/a
8 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 648 CDS 100% 15.000 7.500 Y Zfp984 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.