Transcript: Mouse NM_001177887.1

Mus musculus immunoglobulin superfamily, member 5 (Igsf5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Mus musculus (mouse)
Gene:
Igsf5 (72058)
Length:
1907
CDS:
109..1221

Additional Resources:

NCBI RefSeq record:
NM_001177887.1
NBCI Gene record:
Igsf5 (72058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250379 TCACCGGAGCTGATGGTTAAT pLKO_005 1328 3UTR 100% 13.200 18.480 N Igsf5 n/a
2 TRCN0000250376 ACAGCTTCCGGATCCAGTTAT pLKO_005 163 CDS 100% 13.200 9.240 N Igsf5 n/a
3 TRCN0000175534 CCCTGTATTCCAAGAAGTATT pLKO.1 1370 3UTR 100% 13.200 9.240 N Igsf5 n/a
4 TRCN0000193082 CCTGTATTCCAAGAAGTATTT pLKO.1 1371 3UTR 100% 13.200 9.240 N Igsf5 n/a
5 TRCN0000250377 GAAATGTGACTTTAGTGTAAT pLKO_005 1202 CDS 100% 13.200 9.240 N Igsf5 n/a
6 TRCN0000250378 GCTTCTCATGTGGACTCTTAA pLKO_005 267 CDS 100% 13.200 9.240 N Igsf5 n/a
7 TRCN0000250375 CGCTTCACCTATGCCAGTTAC pLKO_005 340 CDS 100% 10.800 7.560 N Igsf5 n/a
8 TRCN0000173124 CCTTCCTTATCAGGAACTCAA pLKO.1 1113 CDS 100% 0.495 0.297 N Igsf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.