Transcript: Mouse NM_001178060.1

Mus musculus thioredoxin reductase 3 (Txnrd3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Txnrd3 (232223)
Length:
2494
CDS:
257..1762

Additional Resources:

NCBI RefSeq record:
NM_001178060.1
NBCI Gene record:
Txnrd3 (232223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001178060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042357 CGTAGGCTGTATTCCAAAGAA pLKO.1 787 CDS 100% 5.625 7.875 N Txnrd3 n/a
2 TRCN0000435507 GGTGGATGTGACCGAACTTTC pLKO_005 563 CDS 100% 10.800 8.640 N Txnrd3 n/a
3 TRCN0000415291 GCACTGGCCTCCCACTAATAT pLKO_005 2199 3UTR 100% 15.000 10.500 N Txnrd3 n/a
4 TRCN0000042356 CGGAAACAGTAGAAGGGATAT pLKO.1 1092 CDS 100% 10.800 7.560 N Txnrd3 n/a
5 TRCN0000042355 GCAAAGATAATCTGCAACAAA pLKO.1 1529 CDS 100% 5.625 3.938 N Txnrd3 n/a
6 TRCN0000042353 CCCTCACTTTGTTTCCATGAA pLKO.1 2073 3UTR 100% 4.950 3.465 N Txnrd3 n/a
7 TRCN0000042354 CGGAAGAGAAAGCCATCGAAA pLKO.1 1419 CDS 100% 4.950 3.465 N Txnrd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001178060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.