Transcript: Human NM_001184773.2

Homo sapiens seizure related 6 homolog like (SEZ6L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
SEZ6L (23544)
Length:
6581
CDS:
209..3280

Additional Resources:

NCBI RefSeq record:
NM_001184773.2
NBCI Gene record:
SEZ6L (23544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257196 GATCACTCGACCCGCTTAATT pLKO_005 2645 CDS 100% 15.000 21.000 N SEZ6L n/a
2 TRCN0000242493 TACATCCGACCCGACCTATAA pLKO_005 1942 CDS 100% 13.200 18.480 N SEZ6L n/a
3 TRCN0000179590 GCCATCATCGAATGCATCAAT pLKO.1 2021 CDS 100% 5.625 7.875 N SEZ6L n/a
4 TRCN0000242492 TGGAAAGGGCCAGGGATTTAT pLKO_005 2386 CDS 100% 15.000 10.500 N SEZ6L n/a
5 TRCN0000242494 ATGACTCCTGCTCGGATTTAC pLKO_005 2433 CDS 100% 13.200 9.240 N SEZ6L n/a
6 TRCN0000183227 GAGCCTACATTTACATCACAA pLKO.1 3126 CDS 100% 4.950 3.465 N SEZ6L n/a
7 TRCN0000181034 CCAATTCTGCATCTGGACGAT pLKO.1 1636 CDS 100% 2.640 1.848 N SEZ6L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.