Transcript: Mouse NM_001185153.1

Mus musculus zona pellucida binding protein (Zpbp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zpbp (53604)
Length:
3674
CDS:
56..1111

Additional Resources:

NCBI RefSeq record:
NM_001185153.1
NBCI Gene record:
Zpbp (53604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001185153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248233 ACTGTAGAGGAATCTATTAAA pLKO_005 494 CDS 100% 15.000 21.000 N Zpbp n/a
2 TRCN0000248230 TCCACAGGAAGCCTCATATTT pLKO_005 416 CDS 100% 15.000 21.000 N Zpbp n/a
3 TRCN0000215626 GCAACAGTATCTATAACATTT pLKO.1 600 CDS 100% 13.200 10.560 N Zpbp n/a
4 TRCN0000248229 GCAACAGTATCTATAACATTT pLKO_005 600 CDS 100% 13.200 10.560 N Zpbp n/a
5 TRCN0000217502 GTCTGAATGCCATCGTGTTAA pLKO.1 694 CDS 100% 13.200 10.560 N Zpbp n/a
6 TRCN0000248232 GTCTGAATGCCATCGTGTTAA pLKO_005 694 CDS 100% 13.200 10.560 N Zpbp n/a
7 TRCN0000248231 TTTCCAGGGTATGGCATAAAT pLKO_005 962 CDS 100% 15.000 10.500 N Zpbp n/a
8 TRCN0000197671 CCAACTGTAGAGGAATCTATT pLKO.1 491 CDS 100% 13.200 9.240 N Zpbp n/a
9 TRCN0000182485 GTGTAACCCAACGACTGAGAA pLKO.1 312 CDS 100% 4.950 3.465 N Zpbp n/a
10 TRCN0000197625 CCTGTGAAATATCCTTGATTA pLKO.1 672 CDS 100% 13.200 7.920 N Zpbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001185153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.