Transcript: Mouse NM_001190448.1

Mus musculus dopa decarboxylase (Ddc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ddc (13195)
Length:
2018
CDS:
142..1584

Additional Resources:

NCBI RefSeq record:
NM_001190448.1
NBCI Gene record:
Ddc (13195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108479 CTGGGTTAATTGGTGGAATAA pLKO.1 734 CDS 100% 13.200 18.480 N Ddc n/a
2 TRCN0000108478 GCTCCAATGAGTTGAACGAAA pLKO.1 1385 CDS 100% 4.950 6.930 N Ddc n/a
3 TRCN0000316566 GCTCCAATGAGTTGAACGAAA pLKO_005 1385 CDS 100% 4.950 6.930 N Ddc n/a
4 TRCN0000304809 ACCACTCCGTCTTCGTGAAAT pLKO_005 1655 3UTR 100% 13.200 10.560 N Ddc n/a
5 TRCN0000304864 GCAAGGAGATGGTGGATTATA pLKO_005 170 CDS 100% 15.000 10.500 N Ddc n/a
6 TRCN0000304808 CTACTGGCTGCTCGGACTAAA pLKO_005 607 CDS 100% 13.200 9.240 N Ddc n/a
7 TRCN0000108476 CCAGAAACATACGAGGACATA pLKO.1 289 CDS 100% 4.950 3.465 N Ddc n/a
8 TRCN0000108477 CCTTTAATATGGACCCTGTTT pLKO.1 1115 CDS 100% 4.950 3.465 N Ddc n/a
9 TRCN0000316493 CCTTTAATATGGACCCTGTTT pLKO_005 1115 CDS 100% 4.950 3.465 N Ddc n/a
10 TRCN0000108475 GCCTTTAATATGGACCCTGTT pLKO.1 1114 CDS 100% 4.050 2.835 N Ddc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.