Transcript: Mouse NM_001190451.2

Mus musculus decorin (Dcn), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Dcn (13179)
Length:
1902
CDS:
315..1379

Additional Resources:

NCBI RefSeq record:
NM_001190451.2
NBCI Gene record:
Dcn (13179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066205 GCCTGAAAGGACTGATTAATT pLKO.1 1018 CDS 100% 15.000 10.500 N Dcn n/a
2 TRCN0000326892 GCCTGAAAGGACTGATTAATT pLKO_005 1018 CDS 100% 15.000 10.500 N Dcn n/a
3 TRCN0000066203 CCTGTCTAAGAACCAACTAAA pLKO.1 704 CDS 100% 13.200 9.240 N Dcn n/a
4 TRCN0000326827 CCTGTCTAAGAACCAACTAAA pLKO_005 704 CDS 100% 13.200 9.240 N Dcn n/a
5 TRCN0000066206 GTCCGGTATTGGGAAATCTTT pLKO.1 1299 CDS 100% 5.625 3.938 N Dcn n/a
6 TRCN0000354226 GTCCGGTATTGGGAAATCTTT pLKO_005 1299 CDS 100% 5.625 3.938 N Dcn n/a
7 TRCN0000066204 CGACTTCAATGGACTGAACAA pLKO.1 803 CDS 100% 4.950 3.465 N Dcn n/a
8 TRCN0000326826 CGACTTCAATGGACTGAACAA pLKO_005 803 CDS 100% 4.950 3.465 N Dcn n/a
9 TRCN0000066207 CCTGAAGGACTTGCATACCTT pLKO.1 608 CDS 100% 3.000 2.100 N Dcn n/a
10 TRCN0000326894 CCTGAAGGACTTGCATACCTT pLKO_005 608 CDS 100% 3.000 2.100 N Dcn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.