Transcript: Human NM_001190819.1

Homo sapiens origin recognition complex subunit 1 (ORC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ORC1 (4998)
Length:
3177
CDS:
232..2802

Additional Resources:

NCBI RefSeq record:
NM_001190819.1
NBCI Gene record:
ORC1 (4998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144974 GCCACGTTTCAACAGATATAT pLKO.1 2593 CDS 100% 15.000 21.000 N ORC1 n/a
2 TRCN0000292372 GCCACGTTTCAACAGATATAT pLKO_005 2593 CDS 100% 15.000 21.000 N ORC1 n/a
3 TRCN0000139568 CCTGGCAATTGCCAACACAAT pLKO.1 2163 CDS 100% 4.950 6.930 N ORC1 n/a
4 TRCN0000140252 GAAGGTTGTTCCACCGAGATT pLKO.1 346 CDS 100% 4.950 6.930 N ORC1 n/a
5 TRCN0000139902 GAGACCATCATTGGCCTTGTT pLKO.1 610 CDS 100% 4.950 6.930 N ORC1 n/a
6 TRCN0000139324 GCCAGAGCGAATCATGATGAA pLKO.1 2190 CDS 100% 4.950 6.930 N ORC1 n/a
7 TRCN0000292371 GCCAGAGCGAATCATGATGAA pLKO_005 2190 CDS 100% 4.950 6.930 N ORC1 n/a
8 TRCN0000140569 GCTTCACCTGAACATCGCATA pLKO.1 1159 CDS 100% 4.050 5.670 N ORC1 n/a
9 TRCN0000144901 GTCTTGACTATGAATCGGATT pLKO.1 1384 CDS 100% 4.050 5.670 N ORC1 n/a
10 TRCN0000141112 CCACCAAGTCTATGTGCAAAT pLKO.1 1944 CDS 100% 10.800 8.640 N ORC1 n/a
11 TRCN0000292373 CCACCAAGTCTATGTGCAAAT pLKO_005 1944 CDS 100% 10.800 8.640 N ORC1 n/a
12 TRCN0000144900 GAGTTCTGTCTTGACTATGAA pLKO.1 1377 CDS 100% 5.625 3.938 N ORC1 n/a
13 TRCN0000141432 CACATCCAGATTGGACAGTTT pLKO.1 367 CDS 100% 4.950 3.465 N ORC1 n/a
14 TRCN0000292374 CACATCCAGATTGGACAGTTT pLKO_005 367 CDS 100% 4.950 3.465 N ORC1 n/a
15 TRCN0000141915 CTCAGAACTATTTGCGGAGTT pLKO.1 738 CDS 100% 4.050 2.835 N ORC1 n/a
16 TRCN0000142117 GCGGAGTTGAATAAACCACAA pLKO.1 751 CDS 100% 4.050 2.835 N ORC1 n/a
17 TRCN0000141510 GAAAGCAAACTCCTTGACCAT pLKO.1 1771 CDS 100% 2.640 1.848 N ORC1 n/a
18 TRCN0000140777 GCAACTTAGGTAACCCTCAGA pLKO.1 950 CDS 100% 2.640 1.848 N ORC1 n/a
19 TRCN0000292370 GCAACTTAGGTAACCCTCAGA pLKO_005 950 CDS 100% 2.640 1.848 N ORC1 n/a
20 TRCN0000140704 GCTCAAGCATCTAAAGGCCTT pLKO.1 2295 CDS 100% 2.160 1.512 N ORC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.