Transcript: Human NM_001193342.2

Homo sapiens solute carrier family 13 member 3 (SLC13A3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
SLC13A3 (64849)
Length:
3868
CDS:
160..1674

Additional Resources:

NCBI RefSeq record:
NM_001193342.2
NBCI Gene record:
SLC13A3 (64849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042810 CGAGCTGTAATTCGGGAAGAA pLKO.1 838 CDS 100% 4.950 6.930 N SLC13A3 n/a
2 TRCN0000042808 GCTGATATGTACTCGGTCAAT pLKO.1 1603 CDS 100% 4.950 6.930 N SLC13A3 n/a
3 TRCN0000435225 GGATGAATATCGTCGGAACAT pLKO_005 534 CDS 100% 4.950 6.930 N SLC13A3 n/a
4 TRCN0000042812 CCGCAGTGTGACGTGGTGAAT pLKO.1 667 CDS 100% 1.650 2.310 N SLC13A3 n/a
5 TRCN0000427509 TGCTCAGTTTGGCTATGAATA pLKO_005 1538 CDS 100% 13.200 9.240 N SLC13A3 n/a
6 TRCN0000413655 GCCATTATCTAGGATACTTTC pLKO_005 1829 3UTR 100% 10.800 7.560 N SLC13A3 n/a
7 TRCN0000042811 ACTGCCATGATGCTTCCCATT pLKO.1 307 CDS 100% 4.050 2.835 N SLC13A3 n/a
8 TRCN0000174071 ACTGCCATGATGCTTCCCATT pLKO.1 307 CDS 100% 4.050 2.835 N SLC13A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.