Transcript: Human NM_001193508.1

Homo sapiens RE1 silencing transcription factor (REST), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
REST (5978)
Length:
7122
CDS:
137..3430

Additional Resources:

NCBI RefSeq record:
NM_001193508.1
NBCI Gene record:
REST (5978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432087 TCAACGAATCTACCCATATTT pLKO_005 2874 CDS 100% 15.000 21.000 N REST n/a
2 TRCN0000436671 CTAATCGATATGATCACTATA pLKO_005 810 CDS 100% 13.200 18.480 N REST n/a
3 TRCN0000014785 GCCTCTAATCAACATGAAGTA pLKO.1 1157 CDS 100% 4.950 3.960 N REST n/a
4 TRCN0000425937 GCATCCTACTTGTCCTAATAA pLKO_005 1369 CDS 100% 15.000 10.500 N REST n/a
5 TRCN0000014783 CGAGTCTACAAGTGTATCATT pLKO.1 872 CDS 100% 5.625 3.938 N REST n/a
6 TRCN0000014784 GCGTACTCATTCAGGTGAGAA pLKO.1 1105 CDS 100% 4.950 3.465 N REST n/a
7 TRCN0000014786 GTCCTTATTGAAGTTGGCTTA pLKO.1 2642 CDS 100% 4.050 2.835 N REST n/a
8 TRCN0000014787 GCAGCAAATGAGTCTCAGGAA pLKO.1 3128 CDS 100% 2.640 1.848 N REST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.