Transcript: Human NM_001193524.2

Homo sapiens RHO family interacting cell polarization regulator 1 (RIPOR1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RIPOR1 (79567)
Length:
4142
CDS:
118..3819

Additional Resources:

NCBI RefSeq record:
NM_001193524.2
NBCI Gene record:
RIPOR1 (79567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139005 CGGAATCTGAACTCGGATGAT pLKO.1 3361 CDS 100% 4.950 6.930 N RIPOR1 n/a
2 TRCN0000343490 CGGAATCTGAACTCGGATGAT pLKO_005 3361 CDS 100% 4.950 6.930 N RIPOR1 n/a
3 TRCN0000142860 CGATCAGTATGAGATCTGCAT pLKO.1 822 CDS 100% 2.640 3.696 N RIPOR1 n/a
4 TRCN0000142885 CGAGTTTCATCTCCGAATGAA pLKO.1 768 CDS 100% 0.563 0.450 N RIPOR1 n/a
5 TRCN0000121586 CACGGAATTTCTGTCTATTAA pLKO.1 939 CDS 100% 15.000 10.500 N RIPOR1 n/a
6 TRCN0000352870 CACGGAATTTCTGTCTATTAA pLKO_005 939 CDS 100% 15.000 10.500 N RIPOR1 n/a
7 TRCN0000139380 CTCCCTCTACTCACGGAATTT pLKO.1 928 CDS 100% 13.200 9.240 N RIPOR1 n/a
8 TRCN0000144635 GAAGACGAAGATGAAGACAAT pLKO.1 2722 CDS 100% 4.950 2.970 N RIPOR1 n/a
9 TRCN0000343542 GAAGACGAAGATGAAGACAAT pLKO_005 2722 CDS 100% 4.950 2.970 N RIPOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.