Transcript: Human NM_001194.4

Homo sapiens hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 (HCN2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HCN2 (610)
Length:
3420
CDS:
66..2735

Additional Resources:

NCBI RefSeq record:
NM_001194.4
NBCI Gene record:
HCN2 (610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001194.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417625 CCCATCGCGCTCACGCAATAA pLKO_005 3159 3UTR 100% 4.400 6.160 N HCN2 n/a
2 TRCN0000043966 CGTGGAGTGAACTGTACTCCT pLKO.1 1291 CDS 100% 0.264 0.370 N HCN2 n/a
3 TRCN0000043964 CGGGAAGAAGATGTACTTCAT pLKO.1 1796 CDS 100% 4.950 3.465 N HCN2 n/a
4 TRCN0000446083 CCTGATCCGCTACATCCATCA pLKO_005 1091 CDS 100% 4.050 2.835 N HCN2 n/a
5 TRCN0000043967 CGTATTCAACAACCAGGAGAA pLKO.1 2108 CDS 100% 4.050 2.835 N HCN2 n/a
6 TRCN0000043963 GATCTGCAATCTCATCAGCAT pLKO.1 1163 CDS 100% 2.640 1.848 N HCN2 n/a
7 TRCN0000043965 CGTGGACTACATCTTCCTTAT pLKO.1 965 CDS 100% 10.800 6.480 N HCN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001194.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.