Transcript: Human NM_001194956.1

Homo sapiens matrin 3 (MATR3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
MATR3 (9782)
Length:
4193
CDS:
232..1911

Additional Resources:

NCBI RefSeq record:
NM_001194956.1
NBCI Gene record:
MATR3 (9782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001194956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074906 GAGACCGATCTTGCTAATTTA pLKO.1 1399 CDS 100% 15.000 10.500 N MATR3 n/a
2 TRCN0000293553 TCAGGCCGCAGTGGATTATTA pLKO_005 708 CDS 100% 15.000 10.500 N MATR3 n/a
3 TRCN0000102417 CCTTCCTCATTATCAGAAATT pLKO.1 1836 CDS 100% 13.200 9.240 N Matr3 n/a
4 TRCN0000102419 GCCTTCCTCATTATCAGAAAT pLKO.1 1835 CDS 100% 13.200 9.240 N Matr3 n/a
5 TRCN0000308815 GCCTTCCTCATTATCAGAAAT pLKO_005 1835 CDS 100% 13.200 9.240 N Matr3 n/a
6 TRCN0000293617 TGACTTCCTAAGCTACTTAAG pLKO_005 2155 3UTR 100% 10.800 7.560 N MATR3 n/a
7 TRCN0000074904 CCATCAGATAAAGCTGTGAAA pLKO.1 1450 CDS 100% 4.950 3.465 N MATR3 n/a
8 TRCN0000286102 CCATCAGATAAAGCTGTGAAA pLKO_005 1450 CDS 100% 4.950 3.465 N MATR3 n/a
9 TRCN0000074903 CCCGTTATCTTTGACCAGTAT pLKO.1 2580 3UTR 100% 4.950 3.465 N MATR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001194956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.