Transcript: Mouse NM_001195023.1

Mus musculus NPL4 homolog, ubiquitin recognition factor (Nploc4), transcript variant A, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nploc4 (217365)
Length:
4685
CDS:
188..2014

Additional Resources:

NCBI RefSeq record:
NM_001195023.1
NBCI Gene record:
Nploc4 (217365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180313 CCAAATGGTATCTGCACCAAA pLKO.1 788 CDS 100% 4.950 3.960 N Nploc4 n/a
2 TRCN0000319899 CCAAATGGTATCTGCACCAAA pLKO_005 788 CDS 100% 4.950 3.960 N Nploc4 n/a
3 TRCN0000215673 GAACATCAGCTGCAAGATTAA pLKO.1 739 CDS 100% 13.200 9.240 N Nploc4 n/a
4 TRCN0000183195 GCTTCTCAGTTTACATCAATA pLKO.1 315 CDS 100% 13.200 9.240 N Nploc4 n/a
5 TRCN0000319928 GCTTCTCAGTTTACATCAATA pLKO_005 315 CDS 100% 13.200 9.240 N Nploc4 n/a
6 TRCN0000215765 GAAGATGAGATCGATCAATAC pLKO.1 506 CDS 100% 10.800 7.560 N Nploc4 n/a
7 TRCN0000180776 GCCATGTTTGTCACCTTAGTA pLKO.1 3110 3UTR 100% 5.625 3.938 N Nploc4 n/a
8 TRCN0000319900 GCCATGTTTGTCACCTTAGTA pLKO_005 3110 3UTR 100% 5.625 3.938 N Nploc4 n/a
9 TRCN0000195783 CCTGACAACCAGGTTCACTTT pLKO.1 1313 CDS 100% 4.950 3.465 N Nploc4 n/a
10 TRCN0000179251 GCAAATAGAAACAGTCCCTAA pLKO.1 2953 3UTR 100% 4.050 2.835 N Nploc4 n/a
11 TRCN0000319807 GCAAATAGAAACAGTCCCTAA pLKO_005 2953 3UTR 100% 4.050 2.835 N Nploc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.