Transcript: Human NM_001195103.2

Homo sapiens glutathione-disulfide reductase (GSR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GSR (2936)
Length:
3045
CDS:
165..1574

Additional Resources:

NCBI RefSeq record:
NM_001195103.2
NBCI Gene record:
GSR (2936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046424 CACTGATGATACGGCATGATA pLKO.1 937 CDS 100% 5.625 4.500 N GSR n/a
2 TRCN0000046425 CGCCTGAATGCCATCTATCAA pLKO.1 621 CDS 100% 5.625 4.500 N GSR n/a
3 TRCN0000046427 AGACCTATTCAACGAGCTTTA pLKO.1 1327 CDS 100% 10.800 7.560 N GSR n/a
4 TRCN0000046426 CGATGACAAGGGTCATATCAT pLKO.1 1058 CDS 100% 0.563 0.394 N GSR n/a
5 TRCN0000046423 CGGAAGATGAAGCCATTCATA pLKO.1 1285 CDS 100% 0.563 0.394 N GSR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.