Transcript: Mouse NM_001198587.3

Mus musculus neurexin III (Nrxn3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nrxn3 (18191)
Length:
7933
CDS:
682..5397

Additional Resources:

NCBI RefSeq record:
NM_001198587.3
NBCI Gene record:
Nrxn3 (18191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198587.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094192 GCTCTATTATGATGGTTTGAA pLKO.1 4476 CDS 100% 5.625 7.875 N Nrxn3 n/a
2 TRCN0000094189 GCTCCAAGTGAGTCTGTAATA pLKO.1 5763 3UTR 100% 13.200 9.240 N Nrxn3 n/a
3 TRCN0000063569 GCTGCCTTAAAGAGGTTGTTT pLKO.1 1889 CDS 100% 5.625 3.938 N NRXN3 n/a
4 TRCN0000094193 CCATCTACAGAGCCTCATGTT pLKO.1 3180 CDS 100% 4.950 3.465 N Nrxn3 n/a
5 TRCN0000094190 CCACGTCAGATGATCTTGTTT pLKO.1 4697 CDS 100% 5.625 3.375 N Nrxn3 n/a
6 TRCN0000094191 CCCACGTCAGATGATCTTGTT pLKO.1 4696 CDS 100% 4.950 2.970 N Nrxn3 n/a
7 TRCN0000140179 GCACCTCTTCTTCCAGTTCAA pLKO.1 3360 CDS 100% 4.950 2.970 N NRXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198587.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.