Transcript: Mouse NM_001198787.1

Mus musculus apoptosis-associated tyrosine kinase (Aatk), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Aatk (11302)
Length:
5195
CDS:
139..4092

Additional Resources:

NCBI RefSeq record:
NM_001198787.1
NBCI Gene record:
Aatk (11302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361056 GTTCGAATGGGATGGTGATTT pLKO_005 3858 CDS 100% 13.200 18.480 N Aatk n/a
2 TRCN0000361055 CAGTGAAGGTTGGTGATTATG pLKO_005 794 CDS 100% 13.200 10.560 N Aatk n/a
3 TRCN0000023303 CCCATTGTGGAACCCAAACTT pLKO.1 2341 CDS 100% 5.625 4.500 N Aatk n/a
4 TRCN0000361054 CGTGGACAGTGGCTATGATAC pLKO_005 2808 CDS 100% 10.800 7.560 N Aatk n/a
5 TRCN0000023299 CGGCCTCAACTTTGAATACAA pLKO.1 1419 CDS 100% 5.625 3.938 N Aatk n/a
6 TRCN0000023302 CGGGTTCAAGGAGTTTGAGAA pLKO.1 174 CDS 100% 4.950 3.465 N Aatk n/a
7 TRCN0000023300 GCTGTCCTACTTGTGTGCTAA pLKO.1 1179 CDS 100% 4.950 2.970 N Aatk n/a
8 TRCN0000023301 GCTGTGTCCTTCTTCGATGAT pLKO.1 3658 CDS 100% 4.950 2.970 N Aatk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.