Transcript: Human NM_001198850.2

Homo sapiens forkhead box J3 (FOXJ3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FOXJ3 (22887)
Length:
5303
CDS:
273..2141

Additional Resources:

NCBI RefSeq record:
NM_001198850.2
NBCI Gene record:
FOXJ3 (22887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304580 ACGGGCCTCAACTCCATATAG pLKO_005 797 CDS 100% 13.200 18.480 N Foxj3 n/a
2 TRCN0000365608 ACGGGCCTCAACTCCATATAG pLKO_005 797 CDS 100% 13.200 18.480 N FOXJ3 n/a
3 TRCN0000365643 TGGAAGTGTGCATAGTTATAC pLKO_005 1007 CDS 100% 13.200 18.480 N FOXJ3 n/a
4 TRCN0000370843 TGCGACACTTGATATGCTAAA pLKO_005 1643 CDS 100% 10.800 15.120 N FOXJ3 n/a
5 TRCN0000370844 ACAAACTTGCTAATCACTTTA pLKO_005 2225 3UTR 100% 13.200 10.560 N FOXJ3 n/a
6 TRCN0000082209 CCACAGTACAACCTTCCAGAA pLKO.1 1083 CDS 100% 4.050 3.240 N Foxj3 n/a
7 TRCN0000301896 CCACAGTACAACCTTCCAGAA pLKO_005 1083 CDS 100% 4.050 3.240 N Foxj3 n/a
8 TRCN0000365572 GAATCAGTCTCTCAATCATTA pLKO_005 1047 CDS 100% 13.200 9.240 N FOXJ3 n/a
9 TRCN0000020801 AGGTTCAGTTTGCCGATCTTT pLKO.1 1777 CDS 100% 5.625 3.938 N FOXJ3 n/a
10 TRCN0000020803 CACAGAGTAATGTTCAACAAA pLKO.1 1843 CDS 100% 5.625 3.938 N FOXJ3 n/a
11 TRCN0000020799 GCCTTATACATTCACAGAGTA pLKO.1 1831 CDS 100% 4.950 3.465 N FOXJ3 n/a
12 TRCN0000020802 CAGGATGACTTTGATTGGGAT pLKO.1 2109 CDS 100% 2.640 1.848 N FOXJ3 n/a
13 TRCN0000020800 CCCAACACATTGGAACAGGAA pLKO.1 1900 CDS 100% 2.640 1.848 N FOXJ3 n/a
14 TRCN0000370845 GTGATAACTTCCCATATTATA pLKO_005 598 CDS 100% 15.000 9.000 N FOXJ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.