Transcript: Human NM_001198951.1

Homo sapiens ring finger protein 103 (RNF103), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
RNF103 (7844)
Length:
2528
CDS:
16..2061

Additional Resources:

NCBI RefSeq record:
NM_001198951.1
NBCI Gene record:
RNF103 (7844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412652 AGCGATTTGTGGTTCTCATAA pLKO_005 1055 CDS 100% 13.200 18.480 N Rnf103 n/a
2 TRCN0000447345 GACGAAGACCCTGACTTATTC pLKO_005 1450 CDS 100% 13.200 18.480 N Rnf103 n/a
3 TRCN0000007491 CCCGAGGTAAATGATCTGTTT pLKO.1 964 CDS 100% 4.950 6.930 N RNF103 n/a
4 TRCN0000007494 GCCGACATTGTTGCCCTGTTT pLKO.1 1967 CDS 100% 4.950 6.930 N RNF103 n/a
5 TRCN0000320399 GAAACCACACAGGCGAATTTA pLKO_005 902 CDS 100% 15.000 12.000 N RNF103 n/a
6 TRCN0000320469 CTCTGATACCAACTGATTATA pLKO_005 1508 CDS 100% 15.000 10.500 N RNF103 n/a
7 TRCN0000320472 CTTACCAATGTGGCGATTTAA pLKO_005 1536 CDS 100% 15.000 10.500 N RNF103 n/a
8 TRCN0000007492 CCCTCTGATACCAACTGATTA pLKO.1 1506 CDS 100% 13.200 9.240 N RNF103 n/a
9 TRCN0000320470 TTAGTGCAGTGACGGGAAATA pLKO_005 2159 3UTR 100% 13.200 9.240 N RNF103 n/a
10 TRCN0000007490 GCTAATGTTGATGACAGAATT pLKO.1 2188 3UTR 100% 0.000 0.000 N RNF103 n/a
11 TRCN0000320471 ATGACAGATATTGGCATATAT pLKO_005 832 CDS 100% 15.000 9.000 N RNF103 n/a
12 TRCN0000007493 CGAATCGGTTTCTAGTACCAA pLKO.1 282 CDS 100% 3.000 1.500 Y RNF103 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.