Transcript: Human NM_001198980.1

Homo sapiens small ArfGAP2 (SMAP2), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
SMAP2 (64744)
Length:
2519
CDS:
229..1278

Additional Resources:

NCBI RefSeq record:
NM_001198980.1
NBCI Gene record:
SMAP2 (64744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424012 TACACCTCCTAACAGCATAAT pLKO_005 897 CDS 100% 13.200 18.480 N SMAP2 n/a
2 TRCN0000146695 CGACTTTATGAAGCCTATCTT pLKO.1 259 CDS 100% 5.625 7.875 N SMAP2 n/a
3 TRCN0000178957 CCGACTTTATGAAGCCTATCT pLKO.1 258 CDS 100% 4.950 6.930 N SMAP2 n/a
4 TRCN0000295676 ACCGAAGTCTGGACATCAATG pLKO_005 362 CDS 100% 10.800 8.640 N Smap2 n/a
5 TRCN0000413395 ACCGAAGTCTGGACATCAATG pLKO_005 362 CDS 100% 10.800 8.640 N SMAP2 n/a
6 TRCN0000295674 AGTCCTCAGATGTGGAAATAA pLKO_005 1258 CDS 100% 15.000 10.500 N Smap2 n/a
7 TRCN0000437478 TGGATCCCAGACGCCTCAAAT pLKO_005 804 CDS 100% 13.200 9.240 N SMAP2 n/a
8 TRCN0000440319 ACAGCGCCTGTCATGGATTTG pLKO_005 529 CDS 100% 10.800 7.560 N SMAP2 n/a
9 TRCN0000183048 CCTCTCTGTTTGGTTTAGAAA pLKO.1 1369 3UTR 100% 5.625 3.938 N SMAP2 n/a
10 TRCN0000183691 GAAGGATTTATTCGAGACAAA pLKO.1 319 CDS 100% 4.950 3.465 N SMAP2 n/a
11 TRCN0000179767 GCAATACCCTAGAGAAGGATT pLKO.1 599 CDS 100% 4.950 3.465 N SMAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.