Transcript: Mouse NM_001198984.1

Mus musculus treacle ribosome biogenesis factor 1 (Tcof1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Tcof1 (21453)
Length:
4679
CDS:
107..4177

Additional Resources:

NCBI RefSeq record:
NM_001198984.1
NBCI Gene record:
Tcof1 (21453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001198984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295373 CAAGACCGACACCTGTCAATT pLKO_005 420 CDS 100% 13.200 18.480 N Tcof1 n/a
2 TRCN0000295431 CGGCTTGACTGTGGCTAATTC pLKO_005 3373 CDS 100% 13.200 18.480 N Tcof1 n/a
3 TRCN0000295374 AGCAGCTCTCAGGGTCCAAAT pLKO_005 1519 CDS 100% 10.800 7.560 N Tcof1 n/a
4 TRCN0000110801 CCTACAGAATCCAGCGAAGAT pLKO.1 3305 CDS 100% 4.950 3.465 N Tcof1 n/a
5 TRCN0000110802 CCTCATTTACCATCATCTGTT pLKO.1 142 CDS 100% 4.950 3.465 N Tcof1 n/a
6 TRCN0000110800 CGAGGTGAAATCTCCAGCAAA pLKO.1 736 CDS 100% 4.950 3.465 N Tcof1 n/a
7 TRCN0000288097 CGAGGTGAAATCTCCAGCAAA pLKO_005 736 CDS 100% 4.950 3.465 N Tcof1 n/a
8 TRCN0000110804 CCCTCATTTACCATCATCTGT pLKO.1 141 CDS 100% 3.000 2.100 N Tcof1 n/a
9 TRCN0000110803 GCCACCAACAAGCTCGGGAAA pLKO.1 3104 CDS 100% 1.350 0.810 N Tcof1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.