Transcript: Human NM_001198989.2

Homo sapiens NFS1 cysteine desulfurase (NFS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NFS1 (9054)
Length:
2855
CDS:
65..1285

Additional Resources:

NCBI RefSeq record:
NM_001198989.2
NBCI Gene record:
NFS1 (9054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218827 AGCGGCTGATACAGAATATAA pLKO_005 891 CDS 100% 15.000 21.000 N NFS1 n/a
2 TRCN0000179445 GCTCCCTTACCTAATCAACTA pLKO.1 295 CDS 100% 4.950 6.930 N NFS1 n/a
3 TRCN0000178992 CCTCTTATGTGCTTAGAGCAA pLKO.1 1074 CDS 100% 2.640 3.696 N NFS1 n/a
4 TRCN0000182991 CCTTACCTAATCAACTACTAT pLKO.1 299 CDS 100% 5.625 4.500 N NFS1 n/a
5 TRCN0000148031 GCTACTGAATCCAACAACATA pLKO.1 443 CDS 100% 5.625 4.500 N NFS1 n/a
6 TRCN0000229753 CAGTTCCAGAAAGGTATATTT pLKO_005 577 CDS 100% 15.000 10.500 N NFS1 n/a
7 TRCN0000229756 CTGTGACTCCACCAGTTATTC pLKO_005 1857 3UTR 100% 13.200 9.240 N NFS1 n/a
8 TRCN0000229754 GGGACCCTAAGCACCATTATC pLKO_005 942 CDS 100% 13.200 9.240 N NFS1 n/a
9 TRCN0000229755 TGTGAAGCGTCTTCGAGAAAT pLKO_005 1198 CDS 100% 13.200 9.240 N NFS1 n/a
10 TRCN0000179073 CCACAAGCGAATCTCAAAGTT pLKO.1 865 CDS 100% 5.625 3.938 N NFS1 n/a
11 TRCN0000180881 GCGCACTCTTCTATCAGGTTT pLKO.1 1115 CDS 100% 4.950 3.465 N NFS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.