Transcript: Human NM_001199097.2

Homo sapiens BAI1 associated protein 3 (BAIAP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
BAIAP3 (8938)
Length:
4531
CDS:
116..3574

Additional Resources:

NCBI RefSeq record:
NM_001199097.2
NBCI Gene record:
BAIAP3 (8938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127970 GTCGACCTTGCTGGACATTAA pLKO.1 118 CDS 100% 13.200 18.480 N BAIAP3 n/a
2 TRCN0000130746 GACGATGTATCCCTGGTAGAA pLKO.1 902 CDS 100% 4.950 6.930 N BAIAP3 n/a
3 TRCN0000130616 CCGTCTATGATGACCTTCAGT pLKO.1 1818 CDS 100% 3.000 2.400 N BAIAP3 n/a
4 TRCN0000432666 GCTATCTCCAGCAGGTGTTTG pLKO_005 510 CDS 100% 10.800 7.560 N BAIAP3 n/a
5 TRCN0000421038 GGGCAATGTGCAGACGCATTT pLKO_005 3958 3UTR 100% 10.800 7.560 N BAIAP3 n/a
6 TRCN0000436506 GGTACGACAGGATCCTGAATG pLKO_005 1734 CDS 100% 10.800 7.560 N BAIAP3 n/a
7 TRCN0000416328 TCTGCGTGGTCCTCAACAATG pLKO_005 2418 CDS 100% 10.800 7.560 N BAIAP3 n/a
8 TRCN0000128575 GTACTTCAAACAGATCGTCAA pLKO.1 970 CDS 100% 4.050 2.835 N BAIAP3 n/a
9 TRCN0000127651 CTCTTCTATACGGAGCTGCTT pLKO.1 2342 CDS 100% 2.640 1.848 N BAIAP3 n/a
10 TRCN0000127610 CTCTTCCACAGCATCCTCAAT pLKO.1 1862 CDS 100% 4.950 2.970 N BAIAP3 n/a
11 TRCN0000130755 GAGCACTTCCTCTTCGAGATT pLKO.1 833 CDS 100% 4.950 2.970 N BAIAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199097.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.