Transcript: Mouse NM_001199118.1

Mus musculus lipin 3 (Lpin3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lpin3 (64899)
Length:
3396
CDS:
252..2798

Additional Resources:

NCBI RefSeq record:
NM_001199118.1
NBCI Gene record:
Lpin3 (64899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097629 CCGCCACCTTGAAACACAAAT pLKO.1 2918 3UTR 100% 13.200 18.480 N Lpin3 n/a
2 TRCN0000097632 CGGTGTCTAAACCTGAACGAA pLKO.1 2046 CDS 100% 3.000 4.200 N Lpin3 n/a
3 TRCN0000097631 CCCAGAGAGTAAGGAAACCAA pLKO.1 1214 CDS 100% 3.000 2.100 N Lpin3 n/a
4 TRCN0000097633 CCTAAGAGTGACTCAGAGCTA pLKO.1 897 CDS 100% 2.640 1.848 N Lpin3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.