Transcript: Mouse NM_001199227.1

Mus musculus oxysterol binding protein-like 5 (Osbpl5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Osbpl5 (79196)
Length:
3794
CDS:
113..2737

Additional Resources:

NCBI RefSeq record:
NM_001199227.1
NBCI Gene record:
Osbpl5 (79196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375199 AGGAATGGCGCTACCGATATG pLKO_005 2217 CDS 100% 10.800 15.120 N Osbpl5 n/a
2 TRCN0000349943 TAATCGCAAGGAGGAGTATAC pLKO_005 1681 CDS 100% 10.800 15.120 N Osbpl5 n/a
3 TRCN0000313790 GTACCGGCCTTAACGCTAAAG pLKO_005 2962 3UTR 100% 0.000 0.000 N Osbpl5 n/a
4 TRCN0000313858 GGCATCAAGAAACCCTATAAT pLKO_005 1436 CDS 100% 15.000 10.500 N Osbpl5 n/a
5 TRCN0000105112 GCGCCAACATCAACCAGATTT pLKO.1 1845 CDS 100% 13.200 9.240 N Osbpl5 n/a
6 TRCN0000375267 GTCAGCTATTCATTAACTATA pLKO_005 2706 CDS 100% 13.200 9.240 N Osbpl5 n/a
7 TRCN0000105113 GCTGAAGGACATTGCCCAATA pLKO.1 2260 CDS 100% 10.800 7.560 N Osbpl5 n/a
8 TRCN0000105114 AGCGCCAACATCAACCAGATT pLKO.1 1844 CDS 100% 4.950 3.465 N Osbpl5 n/a
9 TRCN0000105111 GCAATGGATCTGACAAGGAAT pLKO.1 348 CDS 100% 4.950 3.465 N Osbpl5 n/a
10 TRCN0000317445 GCAATGGATCTGACAAGGAAT pLKO_005 348 CDS 100% 4.950 3.465 N Osbpl5 n/a
11 TRCN0000105110 GCCATCTCCATTGTATCTGAT pLKO.1 3676 3UTR 100% 4.950 3.465 N Osbpl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.