Transcript: Mouse NM_001199234.1

Mus musculus spectrin beta, non-erythrocytic 4 (Sptbn4), transcript variant sigma6a, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sptbn4 (80297)
Length:
4740
CDS:
106..3831

Additional Resources:

NCBI RefSeq record:
NM_001199234.1
NBCI Gene record:
Sptbn4 (80297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435215 GCTTGACCACGATCGAGAAAC pLKO_005 2459 CDS 100% 10.800 15.120 N Sptbn4 n/a
2 TRCN0000091514 GCGGTCTCTATTACTCAACAA pLKO.1 2148 CDS 100% 4.950 6.930 N Sptbn4 n/a
3 TRCN0000429034 AGGTGGAACAGTACTACTTTG pLKO_005 998 CDS 100% 10.800 7.560 N Sptbn4 n/a
4 TRCN0000428297 GTCATCGGTGGAGGTGCTTAT pLKO_005 2055 CDS 100% 10.800 7.560 N Sptbn4 n/a
5 TRCN0000091516 GCGCAAGAAATTAGGTGAGAT pLKO.1 276 CDS 100% 4.950 3.465 N Sptbn4 n/a
6 TRCN0000091517 GCTGATATTGTGGAGCAACTT pLKO.1 3103 CDS 100% 4.950 3.465 N Sptbn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.