Transcript: Human NM_001199527.2

Homo sapiens uromodulin like 1 (UMODL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
UMODL1 (89766)
Length:
5983
CDS:
479..4603

Additional Resources:

NCBI RefSeq record:
NM_001199527.2
NBCI Gene record:
UMODL1 (89766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053394 GCCGGTTATGTGGTCCTTATT pLKO.1 4454 CDS 100% 13.200 18.480 N UMODL1 n/a
2 TRCN0000053395 CGACACCTTCATACAGGATTA pLKO.1 3319 CDS 100% 10.800 15.120 N UMODL1 n/a
3 TRCN0000053432 CTACCAGGTGTTCTACGAATA pLKO.1 4582 CDS 100% 10.800 15.120 N UMODL1 n/a
4 TRCN0000053393 CCTCGGTTCTTAACTCTTCAA pLKO.1 4716 3UTR 100% 4.950 6.930 N UMODL1 n/a
5 TRCN0000053429 CAACACATACACCAACGTGAT pLKO.1 4189 CDS 100% 4.050 5.670 N UMODL1 n/a
6 TRCN0000053428 GTTACCGAAATGCAGTTGTTT pLKO.1 3983 CDS 100% 5.625 4.500 N UMODL1 n/a
7 TRCN0000053431 CCAGTTCAAGCTGAGGATCTT pLKO.1 4234 CDS 100% 4.950 3.960 N UMODL1 n/a
8 TRCN0000053396 GCTCATTGGAAAGGTCAGAAT pLKO.1 3019 CDS 100% 4.950 3.465 N UMODL1 n/a
9 TRCN0000053397 CCAGTCCAACAACTTCAGCTA pLKO.1 4564 CDS 100% 2.640 1.848 N UMODL1 n/a
10 TRCN0000053430 CCTCAGAATTATAGCGTGTCT pLKO.1 4022 CDS 100% 2.640 1.848 N UMODL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.