Transcript: Human NM_001200.4

Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
BMP2 (650)
Length:
3545
CDS:
1198..2388

Additional Resources:

NCBI RefSeq record:
NM_001200.4
NBCI Gene record:
BMP2 (650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058194 GATCATCTGAACTCCACTAAT pLKO.1 2200 CDS 100% 13.200 18.480 N BMP2 n/a
2 TRCN0000058193 CCGGAGATTCTTCTTTAATTT pLKO.1 1584 CDS 100% 15.000 12.000 N BMP2 n/a
3 TRCN0000058195 CAAGATGCTTTAGGAAACAAT pLKO.1 1669 CDS 100% 5.625 3.938 N BMP2 n/a
4 TRCN0000058197 GCTTCCACCATGAAGAATCTT pLKO.1 1529 CDS 100% 5.625 3.938 N BMP2 n/a
5 TRCN0000058196 ACACCCTTTGTACGTGGACTT pLKO.1 2091 CDS 100% 4.050 2.835 N BMP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.