Transcript: Mouse NM_001201390.1

Mus musculus RIKEN cDNA E330021D16 gene (E330021D16Rik), mRNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
E330021D16Rik (100502936)
Length:
1815
CDS:
300..1415

Additional Resources:

NCBI RefSeq record:
NM_001201390.1
NBCI Gene record:
E330021D16Rik (100502936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001201390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041155 GCTCAGTGTGTGCTTCAGATA pLKO.1 892 CDS 100% 4.950 3.465 N LOC243676 n/a
2 TRCN0000041154 CCACCATCAAAGATGGGTCTT pLKO.1 691 CDS 100% 4.050 2.835 N LOC243676 n/a
3 TRCN0000041153 CCAGTAGAAGTGTCAGCCTTT pLKO.1 1507 3UTR 100% 4.050 2.835 N LOC243676 n/a
4 TRCN0000041157 CCTAGCATCCATCTTCCACAA pLKO.1 332 CDS 100% 4.050 2.835 N LOC243676 n/a
5 TRCN0000041156 GCATGAGAAATCAGGCTGGTT pLKO.1 1370 CDS 100% 2.640 1.848 N LOC243676 n/a
6 TRCN0000007754 GCCACCTTAGTCAAAGGCAAA pLKO.1 1272 CDS 100% 4.050 2.025 Y UBE2Q2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.