Transcript: Human NM_001201457.1

Homo sapiens testis expressed 14, intercellular bridge forming factor (TEX14), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
TEX14 (56155)
Length:
4954
CDS:
119..4612

Additional Resources:

NCBI RefSeq record:
NM_001201457.1
NBCI Gene record:
TEX14 (56155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146944 TCTAAAGTCAGACTACTCTG pXPR_003 AGG 2874 64% 18 0.3006 TEX14 TEX14 76831
2 BRDN0001144991 CTGCGACTCCACGATGAGAG pXPR_003 GGG 359 8% 4 0.0286 TEX14 TEX14 76833
3 BRDN0001146221 GAGTGCACTATTAAACTGTG pXPR_003 TGG 2638 59% 16 -0.0652 TEX14 TEX14 76832
4 BRDN0001147636 TTAAAAAAGCCGTAGTCTCG pXPR_003 GGG 1407 31% 12 -0.2305 TEX14 TEX14 76834
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037469 GCAGACAATAATGCACGAGAA pLKO.1 2347 CDS 100% 4.050 5.670 N TEX14 n/a
2 TRCN0000230134 CTTCAAGATATCCGGTATATT pLKO_005 1625 CDS 100% 15.000 12.000 N TEX14 n/a
3 TRCN0000218028 AGTTCTGTAAGTCTCACTTTG pLKO_005 4716 3UTR 100% 10.800 8.640 N TEX14 n/a
4 TRCN0000196496 GACATATCATTGACGGATATT pLKO.1 3635 CDS 100% 1.320 1.056 N TEX14 n/a
5 TRCN0000194978 CTGTTCAACTTGGTACCTTAA pLKO.1 153 CDS 100% 0.000 0.000 N TEX14 n/a
6 TRCN0000230135 ACGGATTGGCAGCGAGTTATT pLKO_005 3071 CDS 100% 13.200 9.240 N TEX14 n/a
7 TRCN0000218831 ATGATGGAAAGGTACACTTAA pLKO_005 2895 CDS 100% 13.200 9.240 N TEX14 n/a
8 TRCN0000037471 CCGAAACCTTACTATGATATT pLKO.1 1559 CDS 100% 13.200 9.240 N TEX14 n/a
9 TRCN0000195685 CCAGAGGAAATGGCAAGTTTG pLKO.1 3117 CDS 100% 10.800 7.560 N TEX14 n/a
10 TRCN0000037472 CCTACCAAGATTTCCAAGAAT pLKO.1 2584 CDS 100% 5.625 3.938 N TEX14 n/a
11 TRCN0000195135 CCGATGTCAATGTCTATCTAG pLKO.1 1731 CDS 100% 4.950 3.465 N TEX14 n/a
12 TRCN0000037470 CGGATATTCAAGACCTGTCTA pLKO.1 3648 CDS 100% 4.950 3.465 N TEX14 n/a
13 TRCN0000037473 GCTGGAGTCATTTCTGCTCAA pLKO.1 707 CDS 100% 4.050 2.835 N TEX14 n/a
14 TRCN0000218467 AGGAATATCGAGCAGATATTA pLKO_005 2381 CDS 100% 1.500 1.050 N TEX14 n/a
15 TRCN0000267085 AGAAGGCAGCCACAGTGAATC pLKO_005 1407 CDS 100% 10.800 6.480 N 4933405L10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.