Transcript: Human NM_001201465.3

Homo sapiens neuropilin and tolloid like 1 (NETO1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NETO1 (81832)
Length:
2769
CDS:
697..2298

Additional Resources:

NCBI RefSeq record:
NM_001201465.3
NBCI Gene record:
NETO1 (81832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373041 CCGTCTTGGGAGTGCAAATTT pLKO_005 970 CDS 100% 15.000 21.000 N NETO1 n/a
2 TRCN0000378928 ATGCAGAGGGAGGTATCTTTA pLKO_005 836 CDS 100% 13.200 18.480 N NETO1 n/a
3 TRCN0000063553 CGATACAATTTCACACCTGAT pLKO.1 1147 CDS 100% 4.050 3.240 N NETO1 n/a
4 TRCN0000087560 GCAAGTTTAATCATCCTCCAT pLKO.1 730 CDS 100% 2.640 2.112 N Neto1 n/a
5 TRCN0000063554 CCGAAGGAATTGTGGAGTCTA pLKO.1 1232 CDS 100% 4.950 3.465 N NETO1 n/a
6 TRCN0000063555 CCTCATTATCATCTCTGTCAT pLKO.1 1761 CDS 100% 4.950 3.465 N NETO1 n/a
7 TRCN0000063556 GCAACCAAGAAAGGAACAGAA pLKO.1 760 CDS 100% 4.950 3.465 N NETO1 n/a
8 TRCN0000063557 TCTGCCTCATTGGGTCTCTAA pLKO.1 2240 CDS 100% 4.950 3.465 N NETO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.