Transcript: Human NM_001204178.1

Homo sapiens chondrolectin (CHODL), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
CHODL (140578)
Length:
2213
CDS:
206..916

Additional Resources:

NCBI RefSeq record:
NM_001204178.1
NBCI Gene record:
CHODL (140578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134484 GCATATTCATTGATGAGGGTT pLKO.1 1958 3UTR 100% 2.640 2.112 N CHODL n/a
2 TRCN0000134452 GCAAGTATGAACCAGAGATTA pLKO.1 615 CDS 100% 13.200 9.240 N CHODL n/a
3 TRCN0000417403 TAAGTTGTTATCTAGTCAATG pLKO_005 1139 3UTR 100% 10.800 7.560 N CHODL n/a
4 TRCN0000135204 CCCATCAGAATGTGGTTGTTA pLKO.1 687 CDS 100% 5.625 3.938 N CHODL n/a
5 TRCN0000124675 CCCTACCTTTACCAGTGGAAT pLKO.1 560 CDS 100% 4.950 3.465 N Chodl n/a
6 TRCN0000134804 CCTTGTTCTTCTCAAGAGAAA pLKO.1 2041 3UTR 100% 4.950 3.465 N CHODL n/a
7 TRCN0000136392 CAGGTGTAACATGAAGCACAA pLKO.1 586 CDS 100% 4.050 2.835 N CHODL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.